View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15756_high_21 (Length: 205)
Name: NF15756_high_21
Description: NF15756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15756_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 11 - 190
Target Start/End: Complemental strand, 21724891 - 21724714
Alignment:
| Q |
11 |
aagaatattatatctatcaacatattgacctatcaagaaatttatgtgttaatggaatcatttgatatgataatgtaaatcatattgattaaaccaaatt |
110 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21724891 |
aagaatattatatc---caacatattgaccaatcaagaaatttttgtgttaatggaatcatttgatatgataatgtaaatcatattgattaaaccaaatt |
21724795 |
T |
 |
| Q |
111 |
caatcaactcaaccacaaatatatattgcc-aaagttgcaattttaactatttatgctatgcatatatctaataccaaatc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21724794 |
caatcaactcaaccacaaatatatattgccaaaagttgcaattttaactatttatgctatgcatatatctaataccaaatc |
21724714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University