View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15756_low_25 (Length: 212)
Name: NF15756_low_25
Description: NF15756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15756_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 36 - 186
Target Start/End: Original strand, 28022620 - 28022770
Alignment:
| Q |
36 |
agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaagacgagttggaggtgggagtacacaggcaaaatctctgg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022620 |
agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaaaacgagttggaggtgggagtacacaggcaaaatctctgg |
28022719 |
T |
 |
| Q |
136 |
tacaagggtatagagttggataatgagaaaaggattggattctatgctttg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022720 |
tacaagggtatagagttggataatgagaaaaggattggattctatgctttg |
28022770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University