View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15757_high_6 (Length: 273)
Name: NF15757_high_6
Description: NF15757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15757_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 31086844 - 31086765
Alignment:
| Q |
40 |
gcttcactacgccgctatagcgc--tactaactacctaggcttggttgtcattttcattgattataaagcttgtgttttg |
117 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31086844 |
gcttcactacgccgctatagcgcgttattaactacctaggcttggttgtcattttcattgattatcaagcttgtgttttg |
31086765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 167 - 253
Target Start/End: Complemental strand, 43613838 - 43613752
Alignment:
| Q |
167 |
ttatggtgaaaagttactaggagattttgtctctgtaatgtgacaatgccgtcaagtgctacaggcattcaatttcttaattagggg |
253 |
Q |
| |
|
|||||||||||||||| |||| ||| || |||||||||||||||||| ||||||| || |||||||||||||||||||||||||| |
|
|
| T |
43613838 |
ttatggtgaaaagttagagggagctttcgtttctgtaatgtgacaatgctgtcaagttctgcaggcattcaatttcttaattagggg |
43613752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University