View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15757_high_7 (Length: 240)
Name: NF15757_high_7
Description: NF15757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15757_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 24908440 - 24908234
Alignment:
| Q |
19 |
caaagctgcatttggagacaatattttggttctggtcgaatgggtatgtttctgagtccttttatatgaataatgttgaccatggaagttaaaaacggtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24908440 |
caaagctgcatttggagacaatattttggttctggtcgaatgggtatgtttctgagtccttttatatgaataatgttgaccatggaagttaaaaacggtt |
24908341 |
T |
 |
| Q |
119 |
aatcatgctttacaacacaactgaaattaaggtttcacactctaaggagtttcctcacaagacgcccagtagaggaatttgaatgagttgagcagaaaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24908340 |
aatcatgctttacaacacaactgaaattaaggtttcacactctaaggagtttcctcagaagacgcccagtagaggaatttcaatgagttgagcagaaaac |
24908241 |
T |
 |
| Q |
219 |
acctatg |
225 |
Q |
| |
|
||||||| |
|
|
| T |
24908240 |
acctatg |
24908234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University