View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15757_low_5 (Length: 363)
Name: NF15757_low_5
Description: NF15757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15757_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 53 - 347
Target Start/End: Complemental strand, 16591237 - 16590952
Alignment:
| Q |
53 |
tatccctagcaatagggacatcatttgtattgggcatgacaaattgtgtccgtgttannnnnnnnnnnnnnnnnnnnnngaaggatctaaaatgaaaaaa |
152 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
16591237 |
tatccctagcaatagggatatcatttgtatcgggcatgataaattgtgtccgtgttatttttatcctttttcattttttgaaggatctaaaatgaaaaga |
16591138 |
T |
|
| Q |
153 |
tgacataaagttatatttttaatagattttggacggataaaggcttggatcaaaatatatctattcagattttgatatcactcaatcaaacttaaaaatg |
252 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| || ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16591137 |
cgacataaagttatatttttaatagatcttggatgg-------cttggatcaaaatctatctatccagattttgatatcactcaatcaaacttaaaaatg |
16591045 |
T |
|
| Q |
253 |
acgggctgatattagataacaagttttaattatttnnnnnnnnnnnngaaatctacaaggaatcatataaaagaaattttagactcgtattaact |
347 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16591044 |
acaggctgatattagataacaagttttaattatttaaaaaaaaatat--aatctacaaggaatcatataaaagaaattttagactcgtattaact |
16590952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University