View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15757_low_6 (Length: 359)
Name: NF15757_low_6
Description: NF15757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15757_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 20 - 350
Target Start/End: Complemental strand, 41899038 - 41898706
Alignment:
| Q |
20 |
gtctttgaactcaaaataatttgcaaaagaaccaaatttgctttttatataacccccttcaaccaattggaattctttcctttctcttggggttttcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41899038 |
gtctttgaactcaaaataatttgcaaaagaaccaaatttgctttttatataacccccttcaaccaattggaattctttcctttctcttggggttttcttc |
41898939 |
T |
|
| Q |
120 |
ttctctcaatttaccaccacttttgccacttgcatgttgctttataacctttttatcttatcatgtactaggttttaagctttagtttggtagcatttga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41898938 |
ttctctcaatttaccaccacttttgccacttgcatgttgctttataacctttttatcttatcatgtactaggttttaagctttagtttggtagcatttga |
41898839 |
T |
|
| Q |
220 |
attatgtgtatgcgaaagttgaattatcgagtgggctacttgcttttatgaaatactttaaa-aaaacacgatattaag-nnnnnnnnntgtcggttcct |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
41898838 |
attatgtctatgcgaaagttgaattatcgagtgggctacttgcttttatgaaatactttaaaaaaaacacgatattaagaaaaaaaatatgtcggttcct |
41898739 |
T |
|
| Q |
318 |
ccaaaatttggttcttttctcacgaactatctg |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41898738 |
ccaaaatttggttcttttctcacgaactatctg |
41898706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University