View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15758_high_13 (Length: 316)
Name: NF15758_high_13
Description: NF15758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15758_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 17 - 307
Target Start/End: Original strand, 52609588 - 52609878
Alignment:
| Q |
17 |
cttttcatttcaaaatagccttagatttcatgcataatgactgtgtcggttaattatgttttttgagttgtcgctttgtatcgcgcgtgaggacactcgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52609588 |
cttttcatttcaaaatagccttagatttcatgcataatgactgtgtcggctaattatgttttttgagttgtcgctttgtatcgcccgtgaggacactcgt |
52609687 |
T |
 |
| Q |
117 |
caaaggatgtttgatgaaggtgtgatatttgcgagtgcgtttgtttgtggcaaaggttgggattattgaattttatgttaatatgtaatttgtcgattta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52609688 |
caaaggatgtttgatgaaggtgtgatatttgcgagtgcgtttgtttgtggcaaaggttgggattattgaattttatgtcaatatgtaatttgtcgattta |
52609787 |
T |
 |
| Q |
217 |
aggagaatgaatcacatttttcagatttattgtatattgtatataagtgtggatcttgccttctaagtgaatttttgtttttctttcttct |
307 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52609788 |
aggagaatgaatcacattttccagatttattgtatattgtatataagtgtggatcttgccttctaagtgagtttttgtttttctttcttct |
52609878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University