View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15758_high_23 (Length: 237)
Name: NF15758_high_23
Description: NF15758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15758_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 7497816 - 7497614
Alignment:
| Q |
20 |
gttgagatttttggttgaaaagctgtttaatatagt--agataataaggagtggtcccttatcttaaggattttagtcctccannnnnnngttgtcttac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
7497816 |
gttgagatttttggttgaaaagctgtttaatatagtagagataataagaagtggtcccttattataaggattttagtcctcca-ttttttgttgtcttac |
7497718 |
T |
|
| Q |
118 |
atgaagtggtaaagactatatgaannnnnnnnnnnnnnnnnnnnnnattgcacaactgtaaggtccttaattcgaattcaggtgaaggtgtctagcctca |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7497717 |
atgaagtggtaaagactatatgaaacacacacaactcacacacacaattgcacaactgtaaggtccttaattcgaactcaggtgaaggtgtctagcctca |
7497618 |
T |
|
| Q |
218 |
aaat |
221 |
Q |
| |
|
|||| |
|
|
| T |
7497617 |
aaat |
7497614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University