View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15758_high_27 (Length: 219)
Name: NF15758_high_27
Description: NF15758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15758_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 40345753 - 40345942
Alignment:
| Q |
18 |
aattgatagatttgaaaatgatcagctgaatgagcaattaggaaatttgtggttttgtagatagggacgatttgttccctaggaaaatttgttgctatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40345753 |
aattgatagatttgaaaatgatcagctgaatgagcaattaggaaatttgtggttttgtagatagggacgatttgttccctaggaaaatttgttgctatat |
40345852 |
T |
 |
| Q |
118 |
gattgatattatgttgtaaccggggaattaaattggtataatgacatcaacaatatttgatatggtgatcttctattctgagtataatct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
40345853 |
gattgatattatgttgtaaccggggaattaaattggtataatgacatcaacaatatttgatatggtgatcatctattctgagtagaatct |
40345942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 83 - 171
Target Start/End: Original strand, 40347745 - 40347832
Alignment:
| Q |
83 |
gacgatttgttccctaggaaaatttgttgctata-tgattgatattatgttgtaaccggggaattaaattggtataatgacatcaacaat |
171 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| |||||||||||||||| |||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
40347745 |
gacgatttcttccctaggaaaatttgttgatatagtgattgatattatgtt--aaccggggaattaatttggtataatggcatcaacaat |
40347832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 40347638 - 40347667
Alignment:
| Q |
18 |
aattgatagatttgaaaatgatcagctgaa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40347638 |
aattgatagatttgaaaatgatcagctgaa |
40347667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University