View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15758_low_22 (Length: 248)
Name: NF15758_low_22
Description: NF15758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15758_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 33856758 - 33856527
Alignment:
| Q |
1 |
agcctctctcgctcttcatcttctcttctcagccattttcaccatggctgggaagcgtaaaactagctcaaaaaccaccacatccggcaatgccgttacc |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33856758 |
agcctctctcactcttcatcttctcttctcagccattttcaccatggctgggaagcgtaaaactagctcaaaaaccaccacatccggcaatgctgttacc |
33856659 |
T |
 |
| Q |
101 |
gttgattctgtttccggcgacactgtcaccgttaccgctgactcatcttccggcaacactgttcgtaaatctaggagattgacaaagtcatcctcctcat |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33856658 |
gttgattctgtttccggtgacactgtcaccgttaccgctgactcatcttccggcaacactgttcgtaaatctaggagattgacaaagtcatcctcctcat |
33856559 |
T |
 |
| Q |
201 |
ctgctgacgctgtgaatgttgctgctgattca |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33856558 |
ctgctgacgctgtgaatgttgctgctgattca |
33856527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 28213647 - 28213862
Alignment:
| Q |
12 |
ctcttcatcttctcttctcagccattttcaccatggctgggaagcgtaaaactagctcaaaaaccaccacatccggcaatgccgttaccgttgattctgt |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| || ||||||||||||||| ||||||||| |||| | | || |||||||||| ||||||||| |
|
|
| T |
28213647 |
ctcttcacattctcttctcagccattttcaccatggatgagaagcgtaaaactaggtcaaaaacccccaccttcaataacgccgttaccgctgattctgt |
28213746 |
T |
 |
| Q |
112 |
ttccggcgacactgtcaccgttaccgctgactcatcttccggcaacactgttcgtaaatctaggagattgacaaagtcatcct-cctcatctgctgacgc |
210 |
Q |
| |
|
|| || || |||| | |||| | ||| ||||||| ||||||||||||||| |||||||||||||||||||||||||| | |||| ||||||||| | |
|
|
| T |
28213747 |
tttcgatgaagctgtttctgttaacactggttcatctttcggcaacactgttcgcaaatctaggagattgacaaagtcatcttccctcctctgctgacac |
28213846 |
T |
 |
| Q |
211 |
tgtgaatgttgctgct |
226 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
28213847 |
cgtgaatgttgttgct |
28213862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University