View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15759_low_10 (Length: 254)
Name: NF15759_low_10
Description: NF15759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15759_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 31048158 - 31047938
Alignment:
| Q |
19 |
cttttctctaatatcattcaaaaatgattttcactctgtattaagaaacttgaaagagtggtgtgagataaagagaatcagcatcgaaatttccatgagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31048158 |
cttttctctaatatcattcaaaaatgattttcactctgtattaagaaacttgaaagagtggtgtgagataaagagaatcagcatcgaaatttccatgagt |
31048059 |
T |
|
| Q |
119 |
tctagcataatactttcatttttattggctcaataagcccaatttcattgttgaattccaagagaatccaaagtttccttagttatcccattgcagggca |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31048058 |
tctagcataatactttcatttttgttggctcaataagcccaatttcattgttgaattccaagagaatccaaagttcccttagttatcccattgtagggca |
31047959 |
T |
|
| Q |
219 |
caccatccttttccttgatga |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31047958 |
caccatccttttccttgatga |
31047938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University