View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_high_11 (Length: 239)
Name: NF1575_high_11
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_high_11 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 4843 - 4622
Alignment:
| Q |
1 |
tttatatgctttctcagatttgataagagtcttagaaaatatgagactgctttaaagtttccagctgatacaaatttacagttattaagcagaatgtaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4843 |
tttatatgctttctcagatttgataagagtcttagaaaatatgagactgctttaaagtttccagctgatacaaatttacagttattaagcagaatgtaat |
4744 |
T |
|
| Q |
101 |
gcatacgaaaatgtgagacaattcttatagcatcactctcactaaacttttgaacaactgcaccgaatctgtcccataggctttgtcaaaactcggagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4743 |
gcatacgaaaatgtgagacaattcttatagcatcactctcactaaacttttgaacaactgcaccgaatctgtcccataggctttgtcaaaactcggagat |
4644 |
T |
|
| Q |
201 |
cggagagtttcatcattgcaag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4643 |
cggagagtttcatcattgcaag |
4622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 12578 - 12374
Alignment:
| Q |
17 |
gatttgataagagtcttagaaaatatgagactgctttaaagtttccagctgatacaaatttacagttattaagcagaatgt-aatgcatacgaaaatgtg |
115 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||| |||| ||||| ||||||||||||||||||||||||||| |||||| |||| |||| ||| | || |
|
|
| T |
12578 |
gatttgataagagtgttagaaaacatgacactattttattgtttctagctgatacaaatttacagttattaagttgaatgttaatgtatacaaaattatg |
12479 |
T |
|
| Q |
116 |
agacaattcttatagcatcactctcactaaacttttgaacaactgcaccgaatctgtcccataggctttgtcaaaactcggagatcggagagtttcatca |
215 |
Q |
| |
|
||||| |||||| || |||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12478 |
agacagttcttaa--cagcactgtcatgcaacttttgaacaactgcgccgaatctgtcccataggctttgtcaaaactcggagatcggagagtttcatca |
12381 |
T |
|
| Q |
216 |
ttgcaag |
222 |
Q |
| |
|
||||||| |
|
|
| T |
12380 |
ttgcaag |
12374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University