View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_high_12 (Length: 239)
Name: NF1575_high_12
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_high_12 |
 | |
|
| [»] scaffold0131 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0131 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 41 - 182
Target Start/End: Original strand, 13664 - 13805
Alignment:
| Q |
41 |
tttccttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggcgcaa |
140 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||| |
|
|
| T |
13664 |
tttccttgatgtgcagcgcggttttttctatgttgcgtgggggctgtcataggtccagcaggttgtggagtgatcaataggcataattacggtggcgcaa |
13763 |
T |
|
| Q |
141 |
tctggaggtgttaatccggattgtagggctataacttgtgtt |
182 |
Q |
| |
|
||| ||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
13764 |
tctagaggtgttaatccagattgcagggctataagttgtgtt |
13805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 10316781 - 10316690
Alignment:
| Q |
45 |
cttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggc |
136 |
Q |
| |
|
||||||||||| || ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10316781 |
cttgatgtgcaatgcagttttttctttgttgcgtgagggctgtcataggtccagcaggttgtggggtgatcaataggcgtaattacggtggc |
10316690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 45 - 125
Target Start/End: Complemental strand, 4487124 - 4487044
Alignment:
| Q |
45 |
cttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgta |
125 |
Q |
| |
|
||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4487124 |
cttgatgtgaagtgcagttttttctttgttgcgtgggggctgtcataggtccagcaggttgttgggtgatcaataggcgta |
4487044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 49 - 136
Target Start/End: Complemental strand, 22066427 - 22066345
Alignment:
| Q |
49 |
atgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggc |
136 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22066427 |
atgtgcagtgcagttttttctttgttgcgtgggggctgt-----gtccagcaggttgtggggtgatcaataggcgtaattacggtggc |
22066345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 19022549 - 19022463
Alignment:
| Q |
45 |
cttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggc |
136 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||| ||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19022549 |
cttgatgtgcagtgcaattttttctttgttgtgtgggggttgt-----gtccagcaggttgtggggtgatcaataggcgtaattacggtggc |
19022463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University