View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1575_high_12 (Length: 239)

Name: NF1575_high_12
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1575_high_12
NF1575_high_12
[»] scaffold0131 (1 HSPs)
scaffold0131 (41-182)||(13664-13805)
[»] chr3 (1 HSPs)
chr3 (45-136)||(10316690-10316781)
[»] chr7 (1 HSPs)
chr7 (45-125)||(4487044-4487124)
[»] chr5 (2 HSPs)
chr5 (49-136)||(22066345-22066427)
chr5 (45-136)||(19022463-19022549)


Alignment Details
Target: scaffold0131 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: scaffold0131
Description:

Target: scaffold0131; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 41 - 182
Target Start/End: Original strand, 13664 - 13805
Alignment:
41 tttccttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggcgcaa 140  Q
    |||||||||||||||| | |||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||  |||||||||||||    
13664 tttccttgatgtgcagcgcggttttttctatgttgcgtgggggctgtcataggtccagcaggttgtggagtgatcaataggcataattacggtggcgcaa 13763  T
141 tctggaggtgttaatccggattgtagggctataacttgtgtt 182  Q
    ||| ||||||||||||| ||||| |||||||||| |||||||    
13764 tctagaggtgttaatccagattgcagggctataagttgtgtt 13805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 10316781 - 10316690
Alignment:
45 cttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggc 136  Q
    ||||||||||| ||  ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||  |||||||||    
10316781 cttgatgtgcaatgcagttttttctttgttgcgtgagggctgtcataggtccagcaggttgtggggtgatcaataggcgtaattacggtggc 10316690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 45 - 125
Target Start/End: Complemental strand, 4487124 - 4487044
Alignment:
45 cttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgta 125  Q
    ||||||||| ||||  ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||    
4487124 cttgatgtgaagtgcagttttttctttgttgcgtgggggctgtcataggtccagcaggttgttgggtgatcaataggcgta 4487044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 49 - 136
Target Start/End: Complemental strand, 22066427 - 22066345
Alignment:
49 atgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggc 136  Q
    ||||||||||  ||||||||||||||||| |||||||||     |||||||||||||||||||||||||||||||||  |||||||||    
22066427 atgtgcagtgcagttttttctttgttgcgtgggggctgt-----gtccagcaggttgtggggtgatcaataggcgtaattacggtggc 22066345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 19022549 - 19022463
Alignment:
45 cttgatgtgcagtgtggttttttctttgttgcgcgggggctgtcataggtccagcaggttgtggggtgatcaataggcgtagctacggtggc 136  Q
    ||||||||||||||   |||||||||||||| | ||||| |||     |||||||||||||||||||||||||||||||||  |||||||||    
19022549 cttgatgtgcagtgcaattttttctttgttgtgtgggggttgt-----gtccagcaggttgtggggtgatcaataggcgtaattacggtggc 19022463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University