View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_high_17 (Length: 220)
Name: NF1575_high_17
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_high_17 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 39807699 - 39807902
Alignment:
| Q |
17 |
actataacgtttctcaccgaacccattttttctatcagctagccaggttcctctatacatatcaccgtcaacaccgatgaatgaaccaaaaccttccatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39807699 |
actataacgtttctcaccgaacccattttttctatcagctagccaggttcctctatacatatcaccatcaacaccgatgaatgaaccaaaaccttccatt |
39807798 |
T |
|
| Q |
117 |
cgaccggagatgaactcaccttcgtaggttgctcctgatggccaggtgaatcttcctttaccgtttgggtttccgtttttccagtcacctccgtatacac |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39807799 |
cgaccggagatgaaatcaccttcgtaggttgctcctgatggccaggtgaatcttcctttaccgtttggttttccgtttttccagtcacctccgtatacac |
39807898 |
T |
|
| Q |
217 |
agcc |
220 |
Q |
| |
|
|||| |
|
|
| T |
39807899 |
agcc |
39807902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University