View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_low_10 (Length: 244)
Name: NF1575_low_10
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 53172588 - 53172372
Alignment:
| Q |
10 |
cttctaattagatcgttggtatttgtaaaaaataaacaaattgttttgcatccgtgacatatatataattttttcatatcttcgtaaacttggtcaattt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53172588 |
cttcaaattagatcgttggtatttgtaaaaaataaacaaattgttttgcatccgtgacatatatataattttttcatatcttcgtaaacttggtcaattt |
53172489 |
T |
 |
| Q |
110 |
gtcacattatctaaattggcatggcgtgttcacttgtccaattaatgctttttatttagacagtttgccaagttaccaataaactatacacaataacatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53172488 |
gtcacattatctaaattggcatggcgtgttcacttgtccaattaatgctttttatttagacagtttgccaagttaccaataaactatacacaataacatc |
53172389 |
T |
 |
| Q |
210 |
aatttcaatgcttcaaa |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53172388 |
aatttcaatgcttcaaa |
53172372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University