View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_low_16 (Length: 236)
Name: NF1575_low_16
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 17 - 102
Target Start/End: Original strand, 1945436 - 1945522
Alignment:
| Q |
17 |
cataggcaggtgagtgagcgctatttacgaactt-aattaaccataaaactggttaatcattagtattcattaaccttcgatgatag |
102 |
Q |
| |
|
||||||||||||||||||||| ||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1945436 |
cataggcaggtgagtgagcgccatttaggagctttaattaaccataaaactggttaatcattagtattcattaaccttcgatgatag |
1945522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 1945589 - 1945647
Alignment:
| Q |
161 |
gttcaagccgcatgactgagtataaaattgtagaattttttacgtataaaattaccttg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1945589 |
gttcaagccgcatgactgagtataaaattgtagaattttttacgtataaaattaccttg |
1945647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University