View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1575_low_16 (Length: 236)

Name: NF1575_low_16
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1575_low_16
NF1575_low_16
[»] chr1 (2 HSPs)
chr1 (17-102)||(1945436-1945522)
chr1 (161-219)||(1945589-1945647)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 17 - 102
Target Start/End: Original strand, 1945436 - 1945522
Alignment:
17 cataggcaggtgagtgagcgctatttacgaactt-aattaaccataaaactggttaatcattagtattcattaaccttcgatgatag 102  Q
    ||||||||||||||||||||| ||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1945436 cataggcaggtgagtgagcgccatttaggagctttaattaaccataaaactggttaatcattagtattcattaaccttcgatgatag 1945522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 161 - 219
Target Start/End: Original strand, 1945589 - 1945647
Alignment:
161 gttcaagccgcatgactgagtataaaattgtagaattttttacgtataaaattaccttg 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1945589 gttcaagccgcatgactgagtataaaattgtagaattttttacgtataaaattaccttg 1945647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University