View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_low_17 (Length: 235)
Name: NF1575_low_17
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 42518916 - 42519026
Alignment:
| Q |
111 |
aaggtgaatagttggtgaagagtgaagatgaataactcagtagcttcagagaacagttttattattgaaagtgatgaagaagatgataaggattttaaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518916 |
aaggtgaatagttggtgaagagtgaagatgaataactcagtagcttcagagaacagttttattattgaaagtgatgaagaagatgataaggattttaaca |
42519015 |
T |
 |
| Q |
211 |
aaggtgatgat |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
42519016 |
aaggtgatgat |
42519026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 42518806 - 42518838
Alignment:
| Q |
1 |
ttgcattttcgataccaattaatccagatccgg |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42518806 |
ttgcattttcgataccaattaatccagatccgg |
42518838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University