View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1575_low_6 (Length: 319)
Name: NF1575_low_6
Description: NF1575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1575_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 302
Target Start/End: Original strand, 20613849 - 20614131
Alignment:
| Q |
19 |
cggttgttgcaactactggagtagcggtttgcactagagaagatcataatcgaggaatctatgggatttcatatacatgttattgaactagggtagaatt |
118 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20613849 |
cggttgttgcaactattggagtagcagtttgcactagagaagatcataatcgaggaatctatgggatttcatatacacgttattgaactagggtagaatt |
20613948 |
T |
 |
| Q |
119 |
gggattgagatttatattccataacagagagagtgtaagagattattcacaatgctttaaagcttattttttattctctgattgttgaatattacattga |
218 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
20613949 |
gggattgagatttatgttccataacagagagagtgtaagagattattcacaa-gctttaaagcttgttttttattttctgatcgttgaatattacattga |
20614047 |
T |
 |
| Q |
219 |
attgagactttaatctgtaaggtatataactaaaactaactttataagtttgttacaaggatattgttatgctacacctatact |
302 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20614048 |
attgagtttttaatctgtaagctatataactaaaactaactttataagtttgttacaaggatagtgttatgctacacctatact |
20614131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University