View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15761_high_17 (Length: 276)
Name: NF15761_high_17
Description: NF15761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15761_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 53 - 260
Target Start/End: Complemental strand, 43314550 - 43314343
Alignment:
| Q |
53 |
ctcttgtagcaaatgttcgatgaaactagaaatcgacaacacaataaatggcttcccaattcctcaagtagatttgcacagaacccgaaagttgctctga |
152 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43314550 |
ctctcgtagcaaatgttcgatgaaactagaaatcgacaacacaataaatggcttcccaattcctcaagtagatttgcacagaacccgaaagttgttctga |
43314451 |
T |
 |
| Q |
153 |
ttgatcctcacaagtctggttcaagatctgcaatgtccgaatacggagatgatttgtatgactcatatgaagcaacatctcttccttgtcaaattccgcg |
252 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314450 |
ttgatcctcacaagtctggttcgagatctgcaatgtccgaatacggagatgatttgtatgactcctatgaagcaacatctcttccttgtcaaattccgcg |
43314351 |
T |
 |
| Q |
253 |
tcgaatct |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
43314350 |
tcgaatct |
43314343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University