View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15761_low_22 (Length: 234)
Name: NF15761_low_22
Description: NF15761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15761_low_22 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 14 - 234
Target Start/End: Complemental strand, 46503822 - 46503602
Alignment:
| Q |
14 |
acattattatttgttgtcttttccaatgtttctgatgatgttaattgcttcactggtatgaactcttctagaattggttttgctccttgattcgatctaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503822 |
acattattatttgttgtcttttccaatgtttctgatgatgttaattgcttcactggtatgaactcttctagaattggttttgctccttgattcgatctaa |
46503723 |
T |
 |
| Q |
114 |
acgcttgaagttgctgcttcgatgcttccatcgctgaaaattgtgcacgagaaaaattattaattaaagtgacactaacgacaattttacaaatatgtca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46503722 |
acgcttgaagttgctgcttcgatgcttccattgctgaaaattgtgcacgagaaaaattattaattaaagtgacactaacgacaattttacaaatatgtca |
46503623 |
T |
 |
| Q |
214 |
aataagatttgaactcggtct |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46503622 |
aataagatttgaactcggtct |
46503602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 168 - 205
Target Start/End: Original strand, 1082590 - 1082627
Alignment:
| Q |
168 |
aattattaattaaagtgacactaacgacaattttacaa |
205 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1082590 |
aattattaattaaagtgacattaacgacaattttacaa |
1082627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University