View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15762_high_18 (Length: 208)
Name: NF15762_high_18
Description: NF15762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15762_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 43164519 - 43164431
Alignment:
| Q |
104 |
ggttatgaaattcattaatatgattgaagactataaaaagttaaagtgaaaactactaaactaaaggatgatcaacatatgtatttcat |
192 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164519 |
ggttatgaaatttattaatatgattgaagactataaaaagttaaagtgaaaactactaaactaaaggatgatcaacatatgtatttcat |
43164431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University