View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15762_low_16 (Length: 263)
Name: NF15762_low_16
Description: NF15762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15762_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 33238420 - 33238670
Alignment:
| Q |
1 |
tttgatttttcaatgggggatagatgcactcccttttaggaaacaggatggttatgatcttactcaaaaatggaagtggttttgggatgttacaaagaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238420 |
tttgatttttcaatgggggatagatgcactcccttttaggaaacaggatggctatgatcttactcaaaaatggaagtggttttgggatgttacaaagaga |
33238519 |
T |
|
| Q |
101 |
gtgaatcttggaatacaggtaatttaatacaaaattttgttgtacacatacacataaatataagtttattataagatctatgacaaactc--atgaaaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33238520 |
gtgaatcttggaatacaggtaatttaatacaacattttgttgtacacatacacataaatataagtttattataagatctatgacaaactcatatgaaaaa |
33238619 |
T |
|
| Q |
199 |
ct--tagtgattct--tatatatgtttcctatgtgagttactaggtgaaag |
245 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238620 |
cttatagtgattcttatatatatgtttcctatgtgagttactaggtgaaag |
33238670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University