View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15764_low_24 (Length: 250)
Name: NF15764_low_24
Description: NF15764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15764_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 126 - 233
Target Start/End: Complemental strand, 31959504 - 31959397
Alignment:
| Q |
126 |
agggcatgtagaagaaattaatagatacaaaaagaggaatggagaaggtacacttgtcatgaaagggaaagaggaatgttccaagattggaggttcaggt |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||| || ||||||| | |||||||| ||||| |
|
|
| T |
31959504 |
agggcatgtagaagaaattaatggatacaaaaagaggaatggagaatttacacttgtcatgcaagggaaagatgattgttccatgtttggaggtacaggt |
31959405 |
T |
|
| Q |
226 |
ggtatttg |
233 |
Q |
| |
|
|| ||||| |
|
|
| T |
31959404 |
ggcatttg |
31959397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 31959579 - 31959516
Alignment:
| Q |
16 |
ctgcactttgattttgatgctttacgtttcctagatcgatattgtgtgacaatttattgcagtg |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31959579 |
ctgcactttgattttgatgctttacgtttcctagatcgatattgtgtgataatttattgcagtg |
31959516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University