View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15764_low_28 (Length: 236)
Name: NF15764_low_28
Description: NF15764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15764_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 16052816 - 16053027
Alignment:
| Q |
1 |
agttggactaaatgaaaaagtgaaataaatttggtaaaaacgaattgtcaatttctcaatttggtatgttacatgatgttaaaagaggaattaagggcat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16052816 |
agtttgactaaatgaaaaagtgaaataaatttggtaaaaacgaattgtcaatttctcaatttggtatgttacatgatgttaaa-gaggaattaagggcat |
16052914 |
T |
 |
| Q |
101 |
agacaatcaagaatattttgtctagagaatcaagaatcagttgctaaaataatgcattgttggaatttcagcctttgacattttcaacttataaatacat |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16052915 |
agacaatcaagaatattttctctagagaatcaagaatcagttgctaaaataatgcattgctggaatttcagcctttgacattttcaacttataaatacat |
16053014 |
T |
 |
| Q |
201 |
tgacaaccatgat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
16053015 |
tgacaaccatgat |
16053027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University