View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15764_low_33 (Length: 201)
Name: NF15764_low_33
Description: NF15764
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15764_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 49444351 - 49444190
Alignment:
| Q |
19 |
gaagctgatgaattggcgtttcgtaaggcagtaaaagtttggtttcaagttaggagggaaaattataacgggattttgaaagttctaaaagaattccagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49444351 |
gaagctgatgaattggcgtttcgtaaggcagtaaaagtttcgtttcaagttaggaggaaaaattataacgggattttgaaagttctaaaagaattccagg |
49444252 |
T |
|
| Q |
119 |
atcaaagtgtgaaggggttgcttaaaggtcatacagatagaatagaatcacacttccatttcaattt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49444251 |
atcaaagtgtgaaggggttgcttaaaggtcatacagata-----gaatcacacttccatttcaattt |
49444190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 37 - 86
Target Start/End: Original strand, 14961350 - 14961399
Alignment:
| Q |
37 |
tttcgtaaggcagtaaaagtttggtttcaagttaggagggaaaattataa |
86 |
Q |
| |
|
|||||||||||||| |||||| |||||||| || ||||||||||||||| |
|
|
| T |
14961350 |
tttcgtaaggcagtcaaagttgcgtttcaagataagagggaaaattataa |
14961399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University