View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_high_12 (Length: 290)
Name: NF15766_high_12
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 11379359 - 11379618
Alignment:
| Q |
1 |
aggggcttttggagcaatacgagaggcgcacttagcctcactgttttcaaaaccatgaattcacattgtccacggttcacttatttaagtggtatgatca |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379359 |
aggggcttttggagcaatacgag--gcgcacttagcctcactgttttcgaaaccatgaattcacattgtccacggttcacttatttaagtggtatgatca |
11379456 |
T |
 |
| Q |
101 |
caactcagttgtagttttagcgctgtgtataaatgttggtgagcatcaggggcagacctcaacagggcagggtgtggcaatagccacaaatatttttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11379457 |
caactcagttgtagttttagcgttgtgtataaatgttggtgagcatcaggggcagacctgagcagggcagggtatggcaatagccacaaatatttttgtt |
11379556 |
T |
 |
| Q |
201 |
ttctcagcactcactcaacaacagaacacacacattttccttttcccttttctttcccaaat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11379557 |
ttctcagcactcactcaacaacagaacacacacattttccttttcccttttctttcccaaat |
11379618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 2579920 - 2579764
Alignment:
| Q |
1 |
aggggcttttggagcaatacgagaggcgcacttagcctcactgtttt------caa-------aaccatgaattcacattgtccacggttcacttattta |
87 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2579920 |
aggggcttttggagcaatactagaggcgcacttagcctcactgtttttgaaaccaactggttgaaccatgaattgacattgtccacggttcacttattta |
2579821 |
T |
 |
| Q |
88 |
agtggtatgatcacaactcagttgtagttttagcgctgtgtataaatgttggtgagcat |
146 |
Q |
| |
|
|||||||||| |||||||||| || |||| | | ||||| ||||||||||||||||| |
|
|
| T |
2579820 |
agtggtatgacgacaactcagtcgtggttt--gagatgtgtgtaaatgttggtgagcat |
2579764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 48898744 - 48898785
Alignment:
| Q |
147 |
caggggcagacctcaacagggcagggtgtggcaatagccaca |
188 |
Q |
| |
|
||||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
48898744 |
caggggcggacctgagcagggcagggtgtggcaatagccaca |
48898785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University