View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_high_15 (Length: 254)
Name: NF15766_high_15
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 3570276 - 3570496
Alignment:
| Q |
18 |
atgaatgtgaatggttatcatgcaagctatatatcaacactttgtcaattataatgaattaccaaactattgtgtaattgattcttcataaatt----aa |
113 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3570276 |
atgaatgtgaacggtgatcatgcaagctatatatcaacactttgtcaattataatgaattaccaaactattgtgtaattgattcttcataaattaattaa |
3570375 |
T |
|
| Q |
114 |
gtgaatgaaatgaatggtttctttgttttttctttccctcacgttgtcttctaaaaccacttatgaattcgaaactaacaaaataaagtaacatcatatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3570376 |
gtgaatgaaatgaatggtttctttgttttttgtttccctcacgttgtcttctaaaaccacttatgaattcgaaactaacaaaataaagtaacatcatatt |
3570475 |
T |
|
| Q |
214 |
gtgggttccatgtttggcaat |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3570476 |
gtgggttccatgtttggcaat |
3570496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University