View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_high_20 (Length: 207)
Name: NF15766_high_20
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 17 - 170
Target Start/End: Complemental strand, 34843762 - 34843609
Alignment:
| Q |
17 |
aatatcatcagcacatttaagtaaaatggtaagattagatcatgaaccatgatcattgtacatggcgaagggagatcaagagtcacgcagaactcttcat |
116 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34843762 |
aatatcatcagcacatataagtaaaatggtaagattagatcatgaaccatgatcattgtacatggcgaagggagatcaagagtcacacagaactcttcat |
34843663 |
T |
 |
| Q |
117 |
ataagttgaaatataatcgttcaatattccaaccttggttagcttccaaagaag |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34843662 |
ataagttgaaatataatcgttcaatattccaaccttggttagcttccaaagaag |
34843609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University