View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_high_8 (Length: 339)
Name: NF15766_high_8
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 106 - 323
Target Start/End: Complemental strand, 34289391 - 34289169
Alignment:
| Q |
106 |
attatagaaatgtttgttatttagcataaaagaatatactaaaattctcaagaagggaggtatagtatagttta-----ccttgtgtttgaatcattctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34289391 |
attatagaaatgtttgttatttagcataaaagaatatactaaaattctcaagaagggaggtatagtatagtttagtttaccttgtgtttgaatcattctt |
34289292 |
T |
 |
| Q |
201 |
cggatcttgcatgaacaaagaaaactgaaaatatgaaagaggtggaggaagagagcaaaatattttcatttgtattgttaagagtgaagaagagcttttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34289291 |
cggatcttgcatgaacaaagaaaactgaaaatatgaaagaggtggaggaagagagcaaaatattttcatttgtattgttaagagtgaagaagagcttttt |
34289192 |
T |
 |
| Q |
301 |
ggttcagtttgtgacttggcaac |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34289191 |
ggttcagtttgtgacttggcaac |
34289169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 34289470 - 34289414
Alignment:
| Q |
1 |
taaatttagtttaggccttaaaggaataatgtgagcattttctcaacaatcaactgc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34289470 |
taaatttagtttaggccttaaaggaataatgtgagcattttctcaacaatcaactgc |
34289414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University