View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_13 (Length: 305)
Name: NF15766_low_13
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 134 - 240
Target Start/End: Complemental strand, 20968900 - 20968791
Alignment:
| Q |
134 |
acttcaattacttatagtgttggagactcgcttgctttacacaaacaaga---gttcatagttataaaacaaaacaactatcaagcagtgagttgcttca |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20968900 |
acttcatttacttatagtgttggagactcgcttgctttacacaaacaagatcagttcatagttataaaacaaaacaactatcaagcagtgagttgcttca |
20968801 |
T |
 |
| Q |
231 |
aatgttatct |
240 |
Q |
| |
|
|||||||||| |
|
|
| T |
20968800 |
aatgttatct |
20968791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 27 - 119
Target Start/End: Complemental strand, 20969491 - 20969399
Alignment:
| Q |
27 |
acggtgccagcaggcttactccttgcttgtgactgcaataaggcaggaaaccggcactgagatatcagcaatgaatgattcatcctgaaaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20969491 |
acggtgccagcaggcttactccttgcttgtgactgcaataaggcaggaaaccggcaccaagatatcagcaatgaatgattcatcctgaaaatt |
20969399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 146 - 233
Target Start/End: Complemental strand, 20981716 - 20981628
Alignment:
| Q |
146 |
tatagtgttggagactcgcttgctttacacaaa-caagagttcatagttataaaacaaaacaactatcaagcagtgagttgcttcaaat |
233 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20981716 |
tatagagttggagactttcttgctttacacaaaacaagagttcatagttataaaacaaaacaactatcaagcaatgagttgcttcaaat |
20981628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University