View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_16 (Length: 285)
Name: NF15766_low_16
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 106 - 263
Target Start/End: Original strand, 31844406 - 31844566
Alignment:
| Q |
106 |
taaattagggttagtagtagtgatagtagggttattaaggttaagattaagcatagaagaaccttgaat---ttgagctggttcatgagttgttggtggt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
31844406 |
taaattagggttagtagtagtgatagtagggttattaaggttaagattaagcatagaagaaccttcattaagttgagctggttcatgagttgttggtggt |
31844505 |
T |
 |
| Q |
203 |
gatgattgtctaagccttgctctatcccttctatgaacattcatgtgacctccaagtgctt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31844506 |
gatgattgtctaagccttgctctatcccttctatgaacattcatgtgacctccaagtgctt |
31844566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University