View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_17 (Length: 266)
Name: NF15766_low_17
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_17 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 42453767 - 42454020
Alignment:
| Q |
13 |
cacagatgggtgagtttgctgctacaatggagagactgcagtctcttttgagtttccaggattcaacagctacaatgttagttatgatttcgtgtctgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453767 |
cacagatgggtgagtttgctgctacaatggagagactgcagtctcttttgagtttccaggattcaacagctacaatgttagttatgatttcgtgtctgat |
42453866 |
T |
 |
| Q |
113 |
aatagggattgtggctttggctgttcctttccgatatcttgtctttgtttggtttctttattttctaaggcatccaatgttccgttcacctcttcctcca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42453867 |
aatagggattgtggctttggctgttcctttccgatatcttgtctttgtttggtttctttattttctaaggcatccaatgttccgttcaccttttcctcca |
42453966 |
T |
 |
| Q |
213 |
ttttatgaaaattggattcgaaggatgccttcaaaattagatagcatgatatga |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453967 |
ttttatgaaaattggattcgaaggatgccttcaaaattagatagcatgatatga |
42454020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University