View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_19 (Length: 240)
Name: NF15766_low_19
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 4835302 - 4835516
Alignment:
| Q |
18 |
agcagcacagccgcaaaattagtagaatgcgtaaacaacaagtaaacatgtttctttttctgtagctagcttaatttacaacaacaaaactgtagtcatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4835302 |
agcagcacagccgcaaaattagtagaatgcgtaaacaacaagtaaacatgtttctttttctgtagctagcttaatttacatcaacaaaactgtagtcatg |
4835401 |
T |
|
| Q |
118 |
gattgctgaattatagtgactgaccctttacttcaacaaactagggtaggcttggtcttctttattaatcaacgtctctactttctttttgtatcaatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4835402 |
gattgctgaattatagtgactgaccctttacttcaacaaactagggtaggcttggtcttctttattaatcaacgtctctactttctttttgtatcaatta |
4835501 |
T |
|
| Q |
218 |
ttactatagtattat |
232 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
4835502 |
ttattatagtattat |
4835516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 181
Target Start/End: Complemental strand, 34126432 - 34126356
Alignment:
| Q |
104 |
aaactgtagtcatggattgctgaattatagtgactgaccctttacttcaacaaactagggtaggcttggtcttcttta |
181 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||| ||||||||| ||||||||||| |||| |||||| |||||||| |
|
|
| T |
34126432 |
aaactgtagtcatggatcgctgaattatggtgacttaccctttacatcaacaaacta-ggtatgcttggccttcttta |
34126356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University