View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_22 (Length: 214)
Name: NF15766_low_22
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 203
Target Start/End: Complemental strand, 38627359 - 38627176
Alignment:
| Q |
18 |
caaaatagatgtacaaaaatatcattactcaattaagagatgctataaacattctctttctaacactctctcatgtcgggtgaaatccatgtgaatctga |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38627359 |
caaaatagatgtacaaa--tatcattactcaattaagagatgctataaacactctctttctaacactctctcatgtcgggtgaaatccatgtgaatctga |
38627262 |
T |
 |
| Q |
118 |
ccactttatgcgagaccaatttccaaagtataatactcacatgaatttcaagagagtgtgggttagaaagggtgttcatctcactc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
38627261 |
ccactttatgcgagaccaatttccaaagtatagtactcacatgaatttcaagatagtgtgggttagaaagagtgttcatatcactc |
38627176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University