View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_6 (Length: 406)
Name: NF15766_low_6
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_6 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 8e-68; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 223 - 406
Target Start/End: Original strand, 2938998 - 2939195
Alignment:
| Q |
223 |
gccttagcttacacttgcgtgcagttttgtacacattcgtctggtcaattatataattgcgaggtacattagccaccatgggcaaaattagtttgaacat |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2938998 |
gccttagcttacacttgcgtgcagttttgtacacattcgtctggtcaattatataattgtgaggtacattagccaccatgggcaaaattactttgaacat |
2939097 |
T |
 |
| Q |
323 |
--------------tctatcaaacgacgaaacctttcattgtagttgtttttctgcaacagtccaggaacctaaataacactaggttaagcaaaaact |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
2939098 |
ttcatttgccttagtctatcaaacgacgaaacctttcattgtagttgtttttctgcaacagtccgcgaacctaaataacaataggttaagcaaaaact |
2939195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 40 - 132
Target Start/End: Original strand, 2938222 - 2938314
Alignment:
| Q |
40 |
aacggcattataagtttgactgtaaccagcattccctccaggaaaatgagatgctttgttgttggaataaagtccacgaggagagggtgacct |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2938222 |
aacggcattataagtttgactgtaaccagcattccctccaggaaaatgagatgcttcgttgttggaataaagtccacgaggagagggtgacct |
2938314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 2937937 - 2937976
Alignment:
| Q |
1 |
tccacttggcaataacaatctctggtcaatttcagggata |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2937937 |
tccacttggcaataacaatctctggtcaatttaagggata |
2937976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University