View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15766_low_7 (Length: 372)
Name: NF15766_low_7
Description: NF15766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15766_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 25781134 - 25780905
Alignment:
| Q |
18 |
gcaaagtattatgggaattgtttggttgttgattggactcttatagatattgatacgatgtttaatgaagttatcggtgatgtcgttaagcaaacgttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25781134 |
gcaaagtattatgggaattgtttggttgttgattggactcttatagatattgatacgatgtttaatgaagttatcggtgatgtcgttaagcaaacgttgg |
25781035 |
T |
 |
| Q |
118 |
acccttttatgagtaatattgtgcagcatgtgctggagtttggtagagatgatcaaaggttgaagattgttcgtaagttgactcaacacccggatcagct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25781034 |
acccttttatgagtaatattgtgcagcatgtactggagtttggtagagatgatcaaaggttgaagattgttcgtaagttgactcaacacccggatcagct |
25780935 |
T |
 |
| Q |
218 |
agtcgaagtctcgttaaactcatacgggta |
247 |
Q |
| |
|
||| |||| ||||||| ||||||||||||| |
|
|
| T |
25780934 |
agttgaagcctcgttagactcatacgggta |
25780905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 148 - 221
Target Start/End: Original strand, 26386305 - 26386378
Alignment:
| Q |
148 |
tgctggagtttggtagagatgatcaaaggttgaagattgttcgtaagttgactcaacacccggatcagctagtc |
221 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||| ||||| ||| |||||||||| || | ||| ||||||||||| |
|
|
| T |
26386305 |
tgctagagttttgtagtgatgatcaaaggttgcagattattcttaagttgactaaagagccgaatcagctagtc |
26386378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 200
Target Start/End: Original strand, 26381403 - 26381455
Alignment:
| Q |
148 |
tgctggagtttggtagagatgatcaaaggttgaagattgttcgtaagttgact |
200 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||| || ||||||| |
|
|
| T |
26381403 |
tgctggagttttgtagggatgatcaaaggttgcagattgttcttatgttgact |
26381455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University