View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15767_high_10 (Length: 273)
Name: NF15767_high_10
Description: NF15767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15767_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 124 - 244
Target Start/End: Original strand, 13650345 - 13650465
Alignment:
| Q |
124 |
taatgcctctagttcttatttgatttttggtttttagtttaatctgtactctgggatcggagtgttaataaccataggttatttattattagctagaaaa |
223 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13650345 |
taatgcctctggttcttatttgattgttggtttttagtttaatctatactctgggatcagagtgttaataaccataggttatttattattagctagaaaa |
13650444 |
T |
 |
| Q |
224 |
ggagacattgttagaggtaat |
244 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13650445 |
ggagacattgttagaggtaat |
13650465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 50 - 177
Target Start/End: Original strand, 41883758 - 41883890
Alignment:
| Q |
50 |
tttggctagagtttttggtgaatttgtgacactgaaaatcttcccttactat----attgttgttaattgagtagaattaatgcctctagttcttatttg |
145 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||| ||||| ||||||||||||||| |||| | |
|
|
| T |
41883758 |
tttggctatagtttttggtgaatttgtgacactgaaaaacttcctttactatatagattgttgttaattgaatagaactaatgcctctagttcgtattag |
41883857 |
T |
 |
| Q |
146 |
atttttgg-tttttagtttaatctgtactctgg |
177 |
Q |
| |
|
||| | || |||||||||| |||| |||||||| |
|
|
| T |
41883858 |
attgtcggttttttagtttgatctatactctgg |
41883890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University