View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15767_high_7 (Length: 299)
Name: NF15767_high_7
Description: NF15767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15767_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 234
Target Start/End: Complemental strand, 33713782 - 33713565
Alignment:
| Q |
17 |
cataggcataagggtatgaggtaaagttttctaaaatataaggtctaggcaattgctcacaacaagcacctcgaatttccaaaaatatctctcaatggta |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33713782 |
cataagcataagggtatgaggtaaagttttctaaagtataaggtctaggcaattgctcacaacaagcacctcgaacttccaaaaatatctctcaatggta |
33713683 |
T |
|
| Q |
117 |
gttaaatagtagtagttacaaaccgttcgcccgatgtatttttcttctgacttgtatactctaccttggttagcatccataatgctccttttggcattaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33713682 |
gttaaatagtagtagttacaaaccgttcgcccgatgtatttttcttctgacttgtatactctaccttggttagcatccataatgctccttttggcattaa |
33713583 |
T |
|
| Q |
217 |
actggatctcgtaaatgc |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
33713582 |
actggatctcgtaaatgc |
33713565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 276
Target Start/End: Complemental strand, 33713550 - 33713520
Alignment:
| Q |
246 |
ctaaattcatacgcataatatatttgttaat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
33713550 |
ctaaattcatacgcataatatatttgttaat |
33713520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University