View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15768_low_16 (Length: 312)
Name: NF15768_low_16
Description: NF15768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15768_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 10 - 286
Target Start/End: Complemental strand, 6220583 - 6220313
Alignment:
| Q |
10 |
ttaataacagttaaaaatggttgtggtacataatgcataatatatcatgtgttaaatgagacaattcactgaaaatacaacttttgccattgacttgtca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220583 |
ttaataacagttaaaaatggttgtggtacataatgcata-----tcatgtgttaaatgagacaattcactgaaaatacaacttttgccattgacttgtca |
6220489 |
T |
|
| Q |
110 |
gcatgtatatggctttattatcctggaactttgccagccctttttctggggtcctcatttgcttcagtccaatatttctgagagctcgcaaagcacttat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
6220488 |
gcatgtatatggctttattatcctggaactttgccagccctttttctggggtcctcatttgcttcagtccaatatttcagagagctagcaaagcacttat |
6220389 |
T |
|
| Q |
210 |
caatgaccaatatgtttggatccacgtttgaaatctcttcaacgtatgccaactttgaacgtgatatattgttttta |
286 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6220388 |
caatgaccaatatgtttggatccac-attgaaatcccttcaacgtatgccaactttgaacgtgatatattgttttta |
6220313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University