View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15768_low_23 (Length: 249)
Name: NF15768_low_23
Description: NF15768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15768_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 23787043 - 23786864
Alignment:
| Q |
1 |
ccataaattgatgaaaatagaataccaaaattgcaattaaacaaattttatattaaagttagtatccttaattgataactgaatgtgcatcaacgaacag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
23787043 |
ccataaattgatgaaaatagaataccaaaattgcaattaaacaaattttatgttaaagttagtatcctttattgataactgaatgtgcatcaacggccag |
23786944 |
T |
 |
| Q |
101 |
aggcgagcatctgacactcaaacgcatcaaataaatatctgtcactatgatcacaaattaagccagtaaattcatattaa |
180 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
23786943 |
aggcgggcatctgacactcagacgcatcaaataaatatctgtcactatgatcacaaattaagccaataaatgcatattaa |
23786864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 189 - 241
Target Start/End: Complemental strand, 23786830 - 23786779
Alignment:
| Q |
189 |
aatcacaaatttacaaccaatcacaaatttgatgattcaatgcaattcatctc |
241 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23786830 |
aatcacaaatt-acaaccaatcacaaatttgatgattcaatgcaattcatctc |
23786779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University