View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15768_low_26 (Length: 238)

Name: NF15768_low_26
Description: NF15768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15768_low_26
NF15768_low_26
[»] chr3 (1 HSPs)
chr3 (17-198)||(31493789-31493970)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 31493970 - 31493789
Alignment:
17 ataaaaacacataaacatcaatctcaagtattgaaactatcactacctatctacacttaaattataaaatttaatgcataaatacatacaacataacaag 116  Q
    |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31493970 ataaaaacccataaacaacaatctcaagtattgaaactatcactacctatctacacttaaattataaaatttaatgcataaatacatacaacataacaag 31493871  T
117 ttaagataacaccttatcagtaccatacaatcatagtagtagcagtcataaacaataattatacacaaccaatattgcacct 198  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
31493870 ttaagataacaccttatcagtaccatacgatcatagtagtagcagtcataaacaataattatacacaaccaatattgcacct 31493789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University