View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15768_low_31 (Length: 222)
Name: NF15768_low_31
Description: NF15768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15768_low_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 44 - 209
Target Start/End: Original strand, 52379310 - 52379471
Alignment:
| Q |
44 |
atctgataagtaatattaaattttcttggtttaatttaaaatgtaataaaactgataagaaaagaagaactaaattcatcatatatgttgtagcaactac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52379310 |
atctgataagtaatattaaattttcttggtttaatttaaaatgtaataaaactgataagaaaagaagaactaaat---tcatatatgttgtagcaactac |
52379406 |
T |
 |
| Q |
144 |
aaaatattagcacttgtcatgaaaacttaaccaacattatgcactgcatggattttttaagatgat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
52379407 |
aaaatattagcacttgtcatgaaaacttaaccaacattatgtactgcatgga-tttttaagatgat |
52379471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University