View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15768_low_32 (Length: 203)
Name: NF15768_low_32
Description: NF15768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15768_low_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 20 - 142
Target Start/End: Complemental strand, 8077480 - 8077358
Alignment:
| Q |
20 |
aaatcctcggtttgtgcctaatacacaacatgtaaaataagatgtatgcaacaatgtaattgagtttaagttgttaatgagcttcatcaaaattatcagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
8077480 |
aaatcctcggtttgtgcctaatacacaacatgcaaaataagatgtatgcaaccatgtaattgagcttaagtagttaatgtacttcatcaaaattatcagc |
8077381 |
T |
|
| Q |
120 |
ccttgtcctcaaagaatcagggg |
142 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
8077380 |
ccttgtcctcaaggaatcagggg |
8077358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University