View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_high_22 (Length: 417)
Name: NF1576_high_22
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 172 - 399
Target Start/End: Original strand, 47588600 - 47588828
Alignment:
| Q |
172 |
catgcactatttgttttcaatgaaaatttattgaatgcttttttcattttcttctaaaaatgaaagg-aaaaaatcatattattattttaaaatatagag |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47588600 |
catgcactatttgttttcaatgaaaatttattgaatgcttttttcattttcttctaaaaatgaaaggaaaaaaatcatattattattttaaaatatagag |
47588699 |
T |
 |
| Q |
271 |
aaatatcgttcaacattcaaatatattttttctttnnnnnnnnntttaaatatatttttggatataaaatgacaaagattttgcactctttaacatttta |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47588700 |
aaatatcgttcaacattcaaatatattttttctttaaaaaaaaatttaaatatatttttggatataaaatgacatagattttgcactctttaacatttta |
47588799 |
T |
 |
| Q |
371 |
cttagtttggtcataactatgttattagt |
399 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47588800 |
cttagtttggtcataactatgttattagt |
47588828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 84 - 135
Target Start/End: Original strand, 47588511 - 47588562
Alignment:
| Q |
84 |
tcaagtgagttgtaaaattgtatttattttggacgggacgctatcctttcac |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47588511 |
tcaagtgagttgtaaaattgtatttattttggaccggacgctatcctttcac |
47588562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University