View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1576_high_31 (Length: 340)
Name: NF1576_high_31
Description: NF1576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1576_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 322
Target Start/End: Complemental strand, 24392375 - 24392063
Alignment:
| Q |
10 |
acatcatcataaccccaaactctagccatatacaaaggtgtgacacccctcttgttcatggcattaatgttcacacccttgtcaacaaaaaccctaactg |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||| |
|
|
| T |
24392375 |
acatcctcataaccccaaactctagccatatacaaaggtgtgacacccctcttgttcatggcattaaggttcacacctttttcaacaaaaaccctaactg |
24392276 |
T |
 |
| Q |
110 |
tctcaatatcaccactctccactgccatatgcaagggcacattaccttcatcatcttcacattctaagtccaaccctacatcactaagcatcaaggccac |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24392275 |
tctcaacatcaccactctccactgccatatgcaagggcacattaccttcatcatcttcacattctaagtccaaccctacctcactaagcatcaaggccac |
24392176 |
T |
 |
| Q |
210 |
attcttgtgccctttaaatgccgcggcatgaagcgctgtaaggccataatgatcacgatagttgaaattcacacctcgtcgtaatagtaattcgacttcc |
309 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24392175 |
attcgtgtgccctttaaatgccgcggcatgaagtgctgttaggccataatgatcacgatagttcaaattcacacctcgtcgtaacagtaattcgacttcc |
24392076 |
T |
 |
| Q |
310 |
cttacatttccat |
322 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24392075 |
cttacatttccat |
24392063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University