View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15771_low_12 (Length: 226)
Name: NF15771_low_12
Description: NF15771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15771_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4546595 - 4546826
Alignment:
| Q |
1 |
aaactagatttgacaaacgacaatgagtttgtagaattaagaatatgtcttca---------caaaggttacaaacattacttgatcaccttaaatcacc |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4546595 |
aaactagatttgacaaacgacaatgagtttgtagaattaagaatatgtcttcaaacggttcacaaaggttacaaacattacttcatcaccttaaatcacc |
4546694 |
T |
 |
| Q |
92 |
ttccaacgccaatccactcaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcgt |
191 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4546695 |
ttccaacaccaatccactaaaagaaacttcaatttacaaacaaaacaagagagcagcggttcttatttgtttattcgaaggtcaagatgggaatttgcgt |
4546794 |
T |
 |
| Q |
192 |
gttattcttacacaacgtgcttcatctctctc |
223 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |
|
|
| T |
4546795 |
gttattcttacacaacgtgcttcttctctctc |
4546826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University