View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15771_low_5 (Length: 278)
Name: NF15771_low_5
Description: NF15771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15771_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 260
Target Start/End: Original strand, 18443424 - 18443666
Alignment:
| Q |
13 |
aatatatcccataccaagtggttccattttgagtgaaccattggtataatggaaatttctttatttctttaacataattaattattcttctaatcatttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18443424 |
aatatatcccataccaagtggttccattttgagtgaaccattggtataatggaaatttctttatttctttaaca----taattattcttctaatcatttt |
18443519 |
T |
 |
| Q |
113 |
cacttatttaggatgcaaattatgtgtttgatgaccatccttctaattttaaaagaaaatgatactctagtaatttgaatttcaactcaaagataagtaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
18443520 |
cacttatttaggatgcaaattatgtgtttgatgaccatccttctaatttt-aaagaaaatgatactctagtaatttaaatttcagctcaaaaataagtaa |
18443618 |
T |
 |
| Q |
213 |
aatctattaaatattgcaacttatagatcaaatctggatactcctgat |
260 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18443619 |
aatctatcaaatattgcaacttatagatcaaatctggatactcttgat |
18443666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University