View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15771_low_6 (Length: 270)
Name: NF15771_low_6
Description: NF15771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15771_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 46795550 - 46795793
Alignment:
| Q |
1 |
ttggaaaactactagtaacaccaaagttgtagccattatcttgttcaaacattgcagtgttgttacaatctgcaaaattagcatcagggaatggaacaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46795550 |
ttggaaaactactagtaacaccaaagttgtagccattatcttgttcaaacattgcagtgttgttacaatctgcaaaattagtatcagggaatggaacaac |
46795649 |
T |
 |
| Q |
101 |
atcatgatgtgttgatgtagtgaaaggaatagaaagtagtgaatcatcaagaagagtagtattgttatttggaaaatcattattttcaggattgtcaatg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795650 |
atcatgatgtgttgatgt---gaaaggaatagaaagtagtgaatcatcaagaagagtagtattgttatttggaaaatcattattttcaggattgtcaatg |
46795746 |
T |
 |
| Q |
201 |
agaaaagaaagggtactattagggtaagaagaagaagatgatgaaga |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795747 |
agaaaagaaagggtactattagggtaagaagaagaagatgatgaaga |
46795793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University