View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15772_low_4 (Length: 395)
Name: NF15772_low_4
Description: NF15772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15772_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 46222460 - 46222261
Alignment:
| Q |
19 |
acaaggtgttcggattggagtctggaagcgaagaagagttcgttgtgatactcgcgttctccttggctgccgacgacgccgagggaggtagagttcatga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46222460 |
acaaggtgttcggattggagtctggaagcgaagaagagttcgttgtgatactcgcgttctccttggctgccgacgacgccgagggaggtggagttcatga |
46222361 |
T |
|
| Q |
119 |
gtttgacggcgatgggtttaccggaggaagggagagtgccggagtagacaggacc-gaagccaccgtgaccgaggattgtggagaaggagtttgtggcgc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46222360 |
gtttgacggcgatgggtttaccggaggaagggagagtgccggagtagacaggaccggaagccaccgtgaccgaggattgtggagaaggagtttgtggcgc |
46222261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 279 - 382
Target Start/End: Complemental strand, 46222199 - 46222096
Alignment:
| Q |
279 |
ggttcgttttttgttgcggaggcagtggagaagtgcgaggatgaaagagcaaccagggatgacggtggtggtgtagttgttgtttagttgaagcggtggt |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46222199 |
ggttcgttttttgttgcggaggcagtggagaagtgcgaggatgaaagagcaaccggggatgacggtggtggtgtggttgttgtttagttgaagcggtggt |
46222100 |
T |
|
| Q |
379 |
ggtg |
382 |
Q |
| |
|
|||| |
|
|
| T |
46222099 |
ggtg |
46222096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University