View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15773_high_15 (Length: 359)

Name: NF15773_high_15
Description: NF15773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15773_high_15
NF15773_high_15
[»] chr8 (6 HSPs)
chr8 (8-343)||(27986300-27986635)
chr8 (8-343)||(28043602-28043937)
chr8 (236-288)||(27241251-27241303)
chr8 (236-288)||(27247124-27247176)
chr8 (306-343)||(27241303-27241340)
chr8 (306-343)||(27247176-27247213)
[»] chr4 (1 HSPs)
chr4 (8-182)||(23890422-23890593)


Alignment Details
Target: chr8 (Bit Score: 308; Significance: 1e-173; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 8 - 343
Target Start/End: Original strand, 27986300 - 27986635
Alignment:
8 gagcagagataccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27986300 gagcagagataccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttc 27986399  T
108 ttcatccgttaacgatggaatatcgtctacaacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgt 207  Q
    |||||| ||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27986400 ttcatcggttaacgatggaagatcgtcgataacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgt 27986499  T
208 agaatatattgcgccgcgatttctgcggcggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattgtgagaggtattaggttcgg 307  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||    
27986500 agaatatatcgcgccgcgatttctgcggcggttggtggtggtttgtttgtggtggtttgtggaggagaagatggagcattgtgagaggtattagattcgg 27986599  T
308 gattaggctcaggttcgggaatgggattgggattag 343  Q
    ||||||||||||||||||||||||||||||||||||    
27986600 gattaggctcaggttcgggaatgggattgggattag 27986635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 8 - 343
Target Start/End: Original strand, 28043602 - 28043937
Alignment:
8 gagcagagataccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28043602 gagcagagataccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttc 28043701  T
108 ttcatccgttaacgatggaatatcgtctacaacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgt 207  Q
    |||||| ||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28043702 ttcatcggttaacgatggaagatcgtcgataacgccgaacgccgccgtaacttccgacgtagacagtggttttggcgcaaaagataacggcggggattgt 28043801  T
208 agaatatattgcgccgcgatttctgcggcggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattgtgagaggtattaggttcgg 307  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||    
28043802 agaatatatcgcgccgcgatttctgcggcggttggtggtggtttgtttgtggtggtttgtggaggagaagatggagcattgtgagaggtattagattcgg 28043901  T
308 gattaggctcaggttcgggaatgggattgggattag 343  Q
    ||||||||||||||||||||||||||||||||||||    
28043902 gattaggctcaggttcgggaatgggattgggattag 28043937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 236 - 288
Target Start/End: Original strand, 27241251 - 27241303
Alignment:
236 cggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattg 288  Q
    ||||||||||||||||||||||||||||||||||| |||||| ||||||||||    
27241251 cggttggtggtggtttgtttgaggtggtttgtggatgagaaggtggagcattg 27241303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 236 - 288
Target Start/End: Original strand, 27247124 - 27247176
Alignment:
236 cggttggtggtggtttgtttgaggtggtttgtggaggagaagatggagcattg 288  Q
    ||||||||||||||||||||||||||||||||||| |||||| ||||||||||    
27247124 cggttggtggtggtttgtttgaggtggtttgtggatgagaaggtggagcattg 27247176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 306 - 343
Target Start/End: Original strand, 27241303 - 27241340
Alignment:
306 gggattaggctcaggttcgggaatgggattgggattag 343  Q
    |||||||||||||| |||||||||||||||||||||||    
27241303 gggattaggctcagtttcgggaatgggattgggattag 27241340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 306 - 343
Target Start/End: Original strand, 27247176 - 27247213
Alignment:
306 gggattaggctcaggttcgggaatgggattgggattag 343  Q
    |||||||||||||| |||||||||||||||||||||||    
27247176 gggattaggctcagtttcgggaatgggattgggattag 27247213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 8 - 182
Target Start/End: Original strand, 23890422 - 23890593
Alignment:
8 gagcagagataccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttc 107  Q
    |||||| |||||||||||||||||||||| || |||||||||||||||||||| ||| |||||||||||| || ||||||||| ||||||||||| ||||    
23890422 gagcagcgataccagtttccaactgattattctaccaagaggttccagaaaaccgataaccggaggaagttgtcaagatcgaagtcagtggcttcggttc 23890521  T
108 ttcatccgttaacgatggaatatcgtctacaacgccgaacgccgccgtaacttccgacgtagacagtggttttgg 182  Q
    |||||| ||||||||||||| ||||   || ||||||||||||||||| ||||||||||| | |||| |||||||    
23890522 ttcatcggttaacgatggaagatcg---acgacgccgaacgccgccgtgacttccgacgtcgtcagttgttttgg 23890593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University